... 868 CCAGGTGTGATTACAGTAACAATCGACCAGATCTAATAACGTGTCCGC SexAI, Sacll 3E-5EA250 agt;alt; 84-I10 869 ... Spcl, Mlul, Sacl I 3E-5EA?50 X 84-I20a#39; 1081 GGACACGTTATTAGATCTGGTCGCGATGGCAATTAATCACA I082 TCGAGCI I ... Transcription was performed with the AmpliScribe T7 kit (Epicenter) according to the manufacturera#39;s instructions. ... Sequence comparison of the 3a#39; and 5a#39; end of the EBOV genome revealed stretches of complementary nucleotides withinanbsp;...
Title | : | Journal of Virology |
Author | : | |
Publisher | : | - 2005 |
You must register with us as either a Registered User before you can Download this Book. You'll be greeted by a simple sign-up page.
Once you have finished the sign-up process, you will be redirected to your download Book page.
How it works: